My libraries show peaks larger than expected. Can I still sequence these PCR-bubbles?

PCR amplified sequencing libraries frequently display library molecules seemingly about twice the excepted size or even bigger.  In most cases, this phenomenon is caused by over-amplification of the libraries.  These PCR artifacts do occur in cases the PCR reactions run out of essential reagents – in most cases the PCR primers will be exhausted.  If primers are no longer available the PCR products will anneal to each other  (the sequencing adapter sequence will be the by far most common sequences available). The resulting annealing products are often called “PCR-bubbles” and are partly double-stranded and partly single-stranded; thus they migrate considerably slower on agarose gels as well as on Bioanalyzer assays.  Please see below.

Since these artifacts are merely annealing products, the resulting libraries are perfectly sequence-able.  However, the quantification of such libraries by fluorometry will not be precise since the dyes used for these measurements are specific for double-stranded DNA molecules and PCR bubbles contain considerable amounts of single-stranded DNA that will not be measured.   The PCR bubbles can be removed by amplifying the library one more time with a single cycle of PCR (a so-called “Reconditioning PCR“).   For this PCR you could use standard Illumina P5 (AATGATACGGCGACCACCGAGATCT) and P7 (CAAGCAGAAGACGGCATACGAGAT) primers.  The complementary sequences should be located at the very ends of all Illumina sequencing library molecules.  In most cases PCR bubble artifacts can not be removed by SPRI bead size selections or Blue Pippin size selections; if necessary, a “Reconditioning PCR” is the best option.
However, to avoid unnecessary complexity loss of the library and introduction of polymerase errors, it would be best to optimize the library preparation protocol for a lower number of PCR cycles beforehand.

pcr_bubble

 

Another graphic illustrating PCR bubbles (source Illumina Inc.). Please also see: https://support.illumina.com/bulletins/2019/10/bubble-products-in-sequencing-libraries–causes–identification-.html


Category: 04 Library Preparation and QC, 05 Sequencing

← FAQ
Posted in
Latest Tweets
  • Yesterday, the lab got trained on a Mantis (liquid dispenser). Today this visitor shows up and climbed up the stra… ,
  • Writing a great paper may be not enough? Producing an accompanying youtube video might help? An new scRNA-seq prot… ,
  • One of many CCGP reference genomes to become available in the next months - based on work from our long-read sequen… ,
  • Please join our Single-Cell Lunch & Learn with TaKaRa next Wednesday, 06-15 12.30 pm to 1.30 pm GBSF auditorium As… ,