FAQs

01 General Information (14)

Please find all the required information on sample submissions and project scheduling on this page http://dnatech.genomecenter.ucdavis.edu/sample-submission-scheduling/.


Please see this page: Getting Started. You will find information on how to set up an account, billing, data storage & distribution, scheduling, equipment & training, bulletins, research support, seed grants, and more.


We are Located in room #1410 of the GBSF building (the Genome Center).

You can use the map link below

Google Maps


We are available every workday from 9 am to 5 pm.
We will be closed on university holidays.  These are listed here:  http://registrar.ucdavis.edu/calendar/holidays.cfm


The building front doors are open in the morning during business hours. After 5 pm please give us a call at 754-9143 and we will come and let you in.
Our usual business hours are weekdays from 9 am to 5 pm.

Following analysis of each run, users have access to parsed output through the SLIMS server. A SLIMS account will be created for you on your first run, with information about how to access your account distributed via email (you will receive this email before your actual files are available). The main SLIMS page can be reached here.

You can download all your files from SLIMS with your webbrowser (clicking the links) or better with a download manager (e.g for Firefox https://addons.mozilla.org/en-US/firefox/addon/downthemall/ )

However, it is recommended to download with command line tools.  E.g. by running “wget” (built-in into Unix/Linux/Mac/Cygwin operating sytems, available also for Windows) with a command like the following:
wget -r -nH -nc -np -R index.html*    “http://slims.bioinformatics.ucdavis.edu/Data/Your_RANDOM_STRING/” &
This command will download all files into your current working directory.

You can also archive all your data  with RSYNC by following instructions at
http://wiki.bioinformatics.ucdavis.edu/index.php/Archiving_solexa_data .


This page informs on the data processing included with our sequencing services and bioinformatic analysis options.
This page informs on the data processing options for Infinium genotyping data.

Our neighbors from the Bioinformatics Core provide sequence data analysis, statistical evaluations, consulting, and training to help you get the most out of your data. Please contact us for joint consultations with the Bioinformatics Core staff and also for complete analysis packages including sequencing and bioinformatics (e.g. differential gene expression, variant calling).

 

 


Several pieces of equipment are available for use during normal working hours for a nominal ‘instrument use’ fee. To use the Shared Equipment, first you will need to be trained by Core staff (subject to a ‘training fee’, good for one year). Your PI will need to create an account with the Genome Center and supply a DaFIS # or PO for billing. Visit our login site and follow the instructions for “Creating an Account.” Also visit here to learn more about the Training and Use of Core Facility Equipment. To schedule a time for instrument training, please email the responsible staff member.


Please support us by acknowledging our services in your publications. We have received NIH funding for the purchase of some of our instruments and this support should be mentioned. Please add a sentence like this to your acknowledgments: “The sequencing was carried out at the DNA Technologies and Expression Analysis Cores at the UC Davis Genome Center, supported by NIH Shared Instrumentation Grant 1S10OD010786-01.”
Acknowledgments like this constitute a big support for future NIH instrumentation grant applications.


Please contact the core manager, Lutz Froenicke (lfroenicke@ucdavis.edu)  for pricing questions, quotes, and billing questions.

Please contact the administrative team of the Genome Center for further reaching questions:
Our Chief Administrative Officer Sally Ivory (saivory@ucdavis.edu) will assist with all contractual questions.
Please contact our Business Office Manager Gail Setka (gjsetka@ucdavis.edu) for questions about bank transfer, credit card, DaFIS accounts, UC system account strings, and other payment options.


We ask you to mention our services in the acknowledgments of your publications.  This will support our applications to instrumentation grants and thus help to improve our services.
Please see the the details here.
If you feel we contributed intellectually to your project it is appropriate for us to share authorship.  If you have any questions please talk to us about it. For a more detailed discussion of authorships when using a core facility please have a look at the ABRF Authorship Guidelines. These are the community standards most core facilities follow when there are questions about authorship.

The BGI@UCDavis was located in the School of Medicine on the Sacramento campus and did provide sequencing services for large scale sequencing projects up until September 2015. This BGI facility is now closed.  Since our DNA Technologies Core operates the latest generation of sequencers (HiSeq3000/4000),  which offers a 7 times increased throughput compared to the previous generation, our Core is now taking on also large sequencing projects. The DNA Technologies Core is offering all the services previously provided by the BGI@UCDavis. In addition we offer many specialized services and support for custom sequencing projects.


A purchase order (or “PO”)  is only required for customers from outside the UC system.   Please email the POs to both, our Business Office Manager, Gail Setka, and us (at gjsetka@ucdavis.edu and dnatech@ucdavis.edu).

A purchase order is a simple  letter from your financial administrators listing the requested services and prices.
It has to include the full contact information of your financial administrators as well as the name and institution of the Principal Investigator (“PI”).
The PO has to state the specific services requested from us – essentially repeating the information provided in quotes from us or from the recharge rate listing from our webpage.
POs should have an ID number on them which your administration can generate according to their preferences.

Please feel free to use your standard PO forms. This purchase order template, with all the required and suggested fields, is a suggestion:  http://dnatech.genomecenter.ucdavis.edu/wp-content/uploads/2016/04/purchase-order-DNATech3.docx

Please see this page for more information on POs: http://blog.procurify.com/2013/09/23/all-you-ever-needed-to-know-about-purchase-orders/
We did modify a generic PO template from here: http://www.vertex42.com/ExcelTemplates/excel-purchase-order.html

 


If you are interested in receiving information about new services, workshops and other updates from the DNA Technologies and Expression Analysis cores, please subscribe to the dnatech_news list.  Please use the UC Davis email address, if applicable.  To subscribe to the list, send an email to sympa@ucdavis.edu with the following information in the subject line:

subscribe dnatech_news first_name last_name

Unsubscribe

You can unsubscribe from the list by simply sending an email to sympa@ucdavis.edu with the following information in the subject line:

unsubscribe dnatech_news

02 Prices/Recharge Rates (2)

Please check our Prices page for the complete list of pricing for genotyping and sequencing.


A purchase order (or “PO”)  is only required for customers from outside the UC system.   Please email the POs to both, our Business Office Manager, Gail Setka, and us (at gjsetka@ucdavis.edu and dnatech@ucdavis.edu).

A purchase order is a simple  letter from your financial administrators listing the requested services and prices.
It has to include the full contact information of your financial administrators as well as the name and institution of the Principal Investigator (“PI”).
The PO has to state the specific services requested from us – essentially repeating the information provided in quotes from us or from the recharge rate listing from our webpage.
POs should have an ID number on them which your administration can generate according to their preferences.

Please feel free to use your standard PO forms. This purchase order template, with all the required and suggested fields, is a suggestion:  http://dnatech.genomecenter.ucdavis.edu/wp-content/uploads/2016/04/purchase-order-DNATech3.docx

Please see this page for more information on POs: http://blog.procurify.com/2013/09/23/all-you-ever-needed-to-know-about-purchase-orders/
We did modify a generic PO template from here: http://www.vertex42.com/ExcelTemplates/excel-purchase-order.html

 


03 Sample Preparation (3)

Bead based protocols (e.g. Ampure XP, RNAClean XP) and spin column based protocols (Qiagen, Zymo, NorgenBiotek, …) tend to be the most efficient ways to remove chemical contaminants.  For Illumina sequencing we suggest spin column based solutions as the most reliable option. Genomic DNA cleaned up with a spin column further has the advantage that it will always dissolve well.

Multiple protocols are available to remove DNA or RNA contaminations. Please find our suggestions for affordable solutions for Illumina sequencing below.

RNA samples need to be DNA-free  (the RNA isolation protocol should always include a DNAse digestion step; in problematic cases you could use RNA-clean & concentrator kits with DNAse).  On an agarose gel, DNA contamination will be visible as a smear of band of fragments considerably larger than the RNA (>10 kb).  On the Bioanalyzer RNA-chips DNA contamination will be visible in the size range from 4kb to 10 kb.

DNA samples need to be RNA-free  (the DNA isolation protocol should always include a RNAse digestion step; in problematic cases we recommend to use RNAse I  (e.g. adding 1 ul RNAse I to your sample and incubate at 30 degrees C for 20 minutes).   RNAse I does not require a special buffer ( it works in TE buffer)  and can be completely inactivated by heating at 70°C for 15 minutes.  Thus, a removal of the enzyme and of a buffer can be avoided in many cases.  If you want to perform a cleanup, Ampure beads (or similar) or DNA-clean & concentrator kits will work fine.  DNA samples can be QC-ed easily by agarose gel electrophoresis and ethidiumbromide staining. The stain will make both DNA and RNA visible.  RNA will run as an halo-like smear in the range of 50- to 200 bp.


If we prepare the sequencing libraries, we require the ChIP-seq DNA samples to be submitted de-crosslinked and sonicated.   The fragment length should best be between 100 and 300 bp. This will result in the tightest peaks. It is recommended to keep the fragment length under 500 bp in any case.
For ChIP-seq we sometimes need to start out with samples that are to low to measure the concentration.  Otherwise the general DNA sample recommendations do apply (buffer should be EB buffer or EBT; http://dnatech.genomecenter.ucdavis.edu/illumina-library-construction/) and more sample is certainly recommended if available.
General ChIP-seq recommendations would be:
  • The fragment length should be between 100 and 300 bp (up to 400 for the majority of molecules is acceptable).
  • Please make sure to run the input controls on the bioanalyzer or on an agarose gel beforehand and email us an image of these.
  • Sequence one “input control” per cell line/ sample type.
  • It is highly  recommended to verify the enrichment of your regions of interest (e.g. promoter regions) vs. the control samples by qPCR, before submitting the samples for sequencing.

The required read-number per sample will vary from target to target.  For the study of point source transcription factors the ENCODE project recommends to analyze at last 20 million (uniquely mapping) reads ( http://genome.cshlp.org/content/22/9/1813.long#boxed-text-2 ).   Depending on the quality of your preps perhaps 75% of the reads can be expected to be uniquely mapping. ENCODE tends to err on the high side with their recommendations. Thus about 20 million reads per sample should be acceptable but this is likely the minimum number.


Quality and quantity of DNA and RNA is critical for high quality sequencing output. Please make sure your DNA is not degraded and is free of RNA contamination. RNA samples should always be assessed on the bioanalyzer for the absence of gDNA contamination (can be removed with DNaseI treatment followed by a column clean-up; e.g. Zymo “RNA Clean and Concentrator”) and degradation. Preferentially determine the concentrations of your DNA and RNA samples using fluorometry (e.g. with a Qubit or plate reader). The sample purity should be assessed by spectrophotometry (e.g. Nanodrop).  Please see this page for a comprehensive table of sample requirements for sample QC, library preps, or your self-made libraries. Please see the Library Prep Page for details on the library prep processes.  For submission information, including submission forms and shipping details, please visit the Sample Submission & Scheduling page. If you are submitting DNA for PacBio libraries, please follow the PacBio Guidelines for Shipping and Handling.
The  Real-time PCR core can carry out DNA as well as RNA extractions for you.


04 Library Preparation and QC (7)

If we prepare the sequencing libraries, we require the ChIP-seq DNA samples to be submitted de-crosslinked and sonicated.   The fragment length should best be between 100 and 300 bp. This will result in the tightest peaks. It is recommended to keep the fragment length under 500 bp in any case.
For ChIP-seq we sometimes need to start out with samples that are to low to measure the concentration.  Otherwise the general DNA sample recommendations do apply (buffer should be EB buffer or EBT; http://dnatech.genomecenter.ucdavis.edu/illumina-library-construction/) and more sample is certainly recommended if available.
General ChIP-seq recommendations would be:
  • The fragment length should be between 100 and 300 bp (up to 400 for the majority of molecules is acceptable).
  • Please make sure to run the input controls on the bioanalyzer or on an agarose gel beforehand and email us an image of these.
  • Sequence one “input control” per cell line/ sample type.
  • It is highly  recommended to verify the enrichment of your regions of interest (e.g. promoter regions) vs. the control samples by qPCR, before submitting the samples for sequencing.

The required read-number per sample will vary from target to target.  For the study of point source transcription factors the ENCODE project recommends to analyze at last 20 million (uniquely mapping) reads ( http://genome.cshlp.org/content/22/9/1813.long#boxed-text-2 ).   Depending on the quality of your preps perhaps 75% of the reads can be expected to be uniquely mapping. ENCODE tends to err on the high side with their recommendations. Thus about 20 million reads per sample should be acceptable but this is likely the minimum number.


PCR amplified sequencing libraries frequently display library molecules seemingly about twice the excepted size or even bigger.  In most cases this phenomenon is caused by over-amplification of the libraries.  These PCR artifacts do occur in cases the PCR reactions run out of essential reagents – in most cases the PCR primers will be exhausted.  If primers are no longer available the PCR products will anneal to each other  (the sequencing  adapter sequence will be the by far most common sequences available). The resulting annealing products are often called “PCR-bubbles” and are partly double-stranded and partly single stranded; thus they migrate considerably slower on agarose gels as well as on Bioanalyzer assays.  Please see below.

Since these artifacts are merely annealing products, the resulting libraries are perfectly sequence-able.  However the quantification of such libraries by flurometry will not be precise since the dyes used for these measurements are specific for double-stranded DNA molecules and PCR bubbles contain considerable amounts of single-stranded DNA that will not be measured.   The PCR bubbles can be removed by amplifying the library one more time with a single cycle of PCR (a so called “Reconditioning PCR“).   However, to avoid unnecessary complexity loss of the library and introduction of polymerase errors, it would be best to optimize the library preparation protocol  for a lower number of PCR cycles beforehand.

pcr_bubble


Illumina sequencing libraries are usually generated with Y-adapters. These are partly single-stranded and partly double stranded.
A PCR-free library will thus still contain partly single-stranded regions.  These single-stranded regions can lead to several types of Bioanalyzer artifacts.  Most commonly the libraries will appear about 70 to 100 nucleotides longer than expected.  However, we have also encountered PCR-free libraries that ran as shorter molecules as well as dramatically longer molecules.  We have (very rarely) encountered another significant problem: considerable amounts adapter-dimers were not visible on the Bioanalyzer traces of PCR-free libraries.

To accurately QC PCR-free Illumina libraries we recommend the following approach:
–  Take a 1 ul aliquot of your library and run a short PCR (e.g. 6 cycles) with this aliquot.
–  Clean up the PCR reaction with a spin column ( e.g. Qiagen Qiaquick, Zymo DNA -clean, …); do NOT use Ampure beads.
–  Run the cleaned up PCR product on the Bioanalyzer again as well as the original PCR-free library.
The Bioanalyzer trace of the PCR product will represent the true molecule sizes and the true adapter-dimer content the closest.


Strand-Specific RNA Libraries
By default we generate strand-specific RNA-seq libraries. Strand-specific (also known as stranded or directional) RNA-seq libraries substantially enhance the value of an RNA-seq experiment. They add information on the originating strand and thus can precisely delineate the boundaries of transcripts in regions with genes on opposite strands.

There are several ways to accomplish strand-specificity.  We incorporate dUTP during the second-stand synthesis of the cDNA.  The dUTP containing strand will not be amplified by the archaea polymerase used for library amplification, thus preserving the strand information for RNA-seq.  

For single-end sequencing the resulting data will represent the “anti-sense strand”.   When using paired-end sequencing, the forward read of the resulting sequencing data represents the “anti-sense strand” and the reverse read the “sense strand” of the genes (for Trinity transcriptome assemblies the “–RF” orientation flag should be used). Illumina paired-end reads are always inward oriented (with the exception of “jumping” or  “mate-pair” libraries).


Quality and quantity of DNA and RNA is critical for high quality sequencing output. Please make sure your DNA is not degraded and is free of RNA contamination. RNA samples should always be assessed on the bioanalyzer for the absence of gDNA contamination (can be removed with DNaseI treatment followed by a column clean-up; e.g. Zymo “RNA Clean and Concentrator”) and degradation. Preferentially determine the concentrations of your DNA and RNA samples using fluorometry (e.g. with a Qubit or plate reader). The sample purity should be assessed by spectrophotometry (e.g. Nanodrop).  Please see this page for a comprehensive table of sample requirements for sample QC, library preps, or your self-made libraries. Please see the Library Prep Page for details on the library prep processes.  For submission information, including submission forms and shipping details, please visit the Sample Submission & Scheduling page. If you are submitting DNA for PacBio libraries, please follow the PacBio Guidelines for Shipping and Handling.
The  Real-time PCR core can carry out DNA as well as RNA extractions for you.


We have currently 96 indices are available and can pool 96 RNA-seq or genomic sequencing libraries. Bioo Scientific offers NEXTflex barocde sets allowing the pooling of up to 384 libraries. If you are planning to use homebrew versions of indices please consult with us first, as reduced complexity from incorrectly designed indices may cause failures when sequencing your sample.


If you have access to fluorometric DNA quantification and a Bioanalyzer library pooling is not difficult. We offer the pooling of sequencing libraries for a small fee.  Prerequisites for the pooling of customer libraries are:

  • all libraries were generated using the same protocol and are PCR amplified
  • their fragment size distribution is similar (and within the Illumina specs) as demonstrated by Bioanalyzer traces
  • uniquely indexed adapters
  • all libraries need to have DNA concentrations in about the same range

Library pooling requires precise pipetting of very small volumes and we can’t work magic with wildly variable samples.  PCR-free libraries are best quantified by qPCR.  Other libraries can be quantified by fluorometry (e.g. Qubit).  For sequencing libraries generated by the core labs, the pooling is included in the service.

We suggest the following procedure:

  • verify that Bioanalyzer traces of your libraries show the same fragment size distribution
  • quantify each library by fluorometry (Qubit or the plate reader)
  • if necessary dilute some of the highly concentrated libraries (to bring them in line with the others)
  • re-quantify the newly diluted libraries (Qubit)
  • pool the same amounts for each library:  e.g.the same number of femtomoles for each library (the femtomole amount is calculated by multiplying the concentration (in nM) by volume (in ul).
  • quantify the resulting pool by Qubit

 


05 Sequencing (12)

PCR amplified sequencing libraries frequently display library molecules seemingly about twice the excepted size or even bigger.  In most cases this phenomenon is caused by over-amplification of the libraries.  These PCR artifacts do occur in cases the PCR reactions run out of essential reagents – in most cases the PCR primers will be exhausted.  If primers are no longer available the PCR products will anneal to each other  (the sequencing  adapter sequence will be the by far most common sequences available). The resulting annealing products are often called “PCR-bubbles” and are partly double-stranded and partly single stranded; thus they migrate considerably slower on agarose gels as well as on Bioanalyzer assays.  Please see below.

Since these artifacts are merely annealing products, the resulting libraries are perfectly sequence-able.  However the quantification of such libraries by flurometry will not be precise since the dyes used for these measurements are specific for double-stranded DNA molecules and PCR bubbles contain considerable amounts of single-stranded DNA that will not be measured.   The PCR bubbles can be removed by amplifying the library one more time with a single cycle of PCR (a so called “Reconditioning PCR“).   However, to avoid unnecessary complexity loss of the library and introduction of polymerase errors, it would be best to optimize the library preparation protocol  for a lower number of PCR cycles beforehand.

pcr_bubble


Certainly. Please provide a Bioanalyzer profile (we can also generate these), and barcode  sequence information in the sample submission form. We will check the quantity of your libraries using real-time PCR (included in the sequencing price). We suggest to submit your library in at least 15 ul volume at a minimum concentration of 5 nM. Please see the Sample Requirements page for details.  Depending on the sequencing platform, we can work with less library (down to 1 nM), but the quantification becomes less reproducible, the library becomes less stable, and relatively larger amounts of the library get lost sticking to the tube. The best buffer to ​store and ​submit libraries is 10 mM Tris​/0.01% Tween-20 ph=8.0 or 8.4​, but EB buffer is also acceptable. Please use 1.5 ml low-retention tubes ( e.g. Eppendorf ​​DNA LoBind). If you do not provide a Bioanalyzer profile of your library, we will carry out the QC for a fee.
Please note that for the HiSeq3000/HiSeq4000 the libraries should have fragment lengths not longer than 550 bases and few molecules longer than 670 bp.


We generate libraries for sequencing with Illumina and PacBio instruments. Illumina libraries include genomic DNA, RNA-seq, ChIP-seq, micro RNA, small RNA, Methyl-seq, RRBS, and reduced representation libraries suitable for GBS analyses, Tag-Seq, and Tn-Seq. Please inquire with us if your protocol is not currently listed. Please see the Library Prep page and the Sample Requirements page for details.  We carry out library QC via Bioanalyzer, library size-selections, pooling of sequencing libraries, and real-time quantitative PCR to accurately measure the concentration of sequence-able library molecules to achieve optimal sequencing output.


The table below shows the wide range of outputs from the sequencing platforms currently available in the Core. Illumina and PacBio offer very complementary technologies (Illumina: very high output, but shorter reads; PacBio: long reads at lower throughput). The choice of platform depends on the data requirements for your project – please contact us to discuss your options.

Sequencing Platforms HiSeq3000/4000 HiSeq2500 – Rapid Mode HiSeq2500 – High Output 1 MiSeq PacBio RS II
Sequencing Output per Lane average 104-110 Gb * up to 45 Gb up to 36 Gb 1 up to 15 Gb 500 Mb to 1 Gb  (official estimate after titration; potentially up to 1.2 Gb very dependent on library type, DNA quality, library titration)
Reads per Lane
in Millions (i.e. Clusters Passing Filter **)
average 340 -370 M * up to 170 M up to 200 M up to 17 M (v2)  up to 25 M (v3) 20-60 K
Read Length up to 2x 150bp up to 2x 250bp up to 2x 100bp up to 2x 300bp average 9-12kb, N50 up to 17kb
Typical Sequencing Format
SR (single reads), PE (paired end reads)
SR50, PE100, PE150 SR100, PE150, PE250 SR50, PE100 1 SR50, PE75 (v3), PE150, PE250, PE300 (v3) 1-3kb (CCS), 2kb, 5kb, 10kb, 20kb, 30kb

* The average yield for HiSeq 3000/4000 lanes and customer prepared libraries is 340 million clusters passing filter.  For libraries prepared by our facility the average yield is higher at about 370 million clusters.  The core-prepared libraries tend to show better size selection ( narrower fragment size range) and adhere closely to the recommendations for the Hiseq3000/4000 libraries and thus tend to cluster more efficiently than the average library.
** The number of “clusters passing filter” is equivalent to the number of “reads passing filter”  for single-end sequencing runs.  For paired-end sequencing the number of reads is twice the number of clusters according to the way Illumina is counting reads.
1 Due to the much higher read numbers enabled by the Hiseq 3000/4000 sequencers, we usually do not run the Hiseq 2500 in High Output mode anymore.  Please inquire with us if you would like to run entire flow-cells..


All sequencing data will be available for secure download via our SLIMS server.

Illumina sequencing data will be delivered as compressed FASTQ files. By default the data will be de-multiplexed (e.g. split according to sample).  Each SLIMS directory will further contain a file with the de-multiplexing metrics and a file listing md5 checksums  for all the FASTQ files. The checksums can be used to verify that the data integrity has been preserved your download/data transfer.
You will receive all the full-length reads passing the Illumina quality filter. Please contact us if you would like to receive the data quality-trimmed, adapter-trimmed, or adapter-filtered.

For PacBio sequencing you will receive all the data generated by the PacBio SMRT-Portal pipeline (raw data and primary analysis data) including FASTA and FASTQ files as well as the “bax.h5” and “.xml” files required to re-run the analyses.  By default we are running also subread filtering as the secondary analysis (except for large gnome projects where this is not required) or other appropriate secondary analysis pipelines for bacterial genome assembly, amplicon analysis, or Iso-seq analyses.  You will receive the complete secondary analysis data sets.


Work in the Core is performed on a “first come, first served” basis. HiSeq sequencing data will typically be delivered within about two to five weeks after library submission, while MiSeq has a 5-8 day turnaround time. The turnaround time can fluctuate and is dependent on the number of customer samples in the queue and the read types and lengths requested.  Similarly library prep projects will be grouped according to the requested library prep protocols to allow for efficient processing.


Unfortunately not.  The samples are put into library prep and sequencing queues after we have received both, the submission form and the sample.  Submission forms have to be submitted in hard-copy (accompanying the samples) and electronically (please email the spreadsheet forms to us).


DNA samples and sequencing libraries will be stored at -20 degrees.  RNA samples will be stored at  -70 degrees C. However samples and libraries will only be stored for one year after sample submission.  Please notify us two days in advance if you plan to pick up your samples. Please arrange the sample pick-up within two months of the data delivery.   Please provide a FedEx account number and a shipping address if your samples should be shipped back. If possible submit aliquots of your samples to our cores for analysis and store a backup aliquot in your lab.


The sequencing data will be available to you on our SLIMS servers for three months after they are generated. In most cases they will accessible for about 6 months. Nevertheless it is recommend to download and verify your data at your earliest convenience after receiving the email notification of their availability.


Custom sequencing primers can enable some unique assays. However, it is certainly worth exploring if the assays can not be converted to use standard Illumina sequencing primers.
Custom sequencing primers can be used for all reads on the Miseq and NextSeq sequencers. Illumina does not support custom primers on the HiSeq 4000 at all, but we can spike them in for the forward read.

Please provide an aliquot for each custom primer (10 ul at 100 uM) with the library submission.   Please note that the customer carries the responsibility for any failures due to bad custom primers or poorly designed custom primers.


We are carrying out a lot of 16S sequencing – almost daily with customer prepared samples.
In case you will be generating the amplicons yourself, we will be happy to  add adapters (required by some protocols) and sequence them on our MiSeqs.
We are not generating 16S libraries ourselves because UC Davis has a facility specializing in 16S analysis: The Host Microbe Biology Systems Core  (HSMBC; also located in our building).  The HSMBC offers a complete service ranging from DNA isolation, 16S amplification, sequencing (this part is performed here), to data analysis.  You can certainly also pick selected parts of their service that you would require.  Please contact the HSMBC manager for details.

The DNA Technologies and Expression Analysis Cores do not offer Sanger DNA Sequencing, but these services are available on campus. See the UC DNA Sequencing Facility or the CAES Genomics Facility for more information. There are multiple other service facilities that may be of interest, including the Veterinary Genetics Laboratory, CCM Mouse Biology Program, and Real-time PCR Research and Diagnostics Core Facility. If we missed out any UC Davis facilities that you would like us to list here, please contact us.


06 Sequencing Data (5)

We are using the NEXTflex™ Small RNA-Seq kit for the generation of micro RNA and small RNA-seq libraries because it significantly reduces sequence-specific biases in the library preparation.  For this purpose the adapters oligonucleotides contain 4 randomized bases at the ligation junctions.  These randomized bases should be removed by trimming before mapping the sequence reads.  BiooScientific recommends this procedure:

Data Analysis for micro RNA data generated with the BiooScientific kits:
The 3′ and 5′ adapters included in this kit both contain 4 random bases that will appear immediately 5′ and 3′ to the insert in sequencing data. The presence of these random bases should be considered when choosing an alignment strategy. When using “end-to-end” alignment, we recommend processing data in the following manner: 1. Clip the 3′ adapter sequence (TGGAATTCTCGGGTGCCAAGG  ; this sequence fragment is sufficient!). 2. Trim the first and last 4 bases from the adapter-clipped reads. 3. Perform alignments as normal. Alternatively, alignment may be performed in “local” mode.

Please find the full adapter sequences for your reference here:  Bioo-Scientific-Small-RNA-Barcode-Indices-v1-1-15 adapters barcodes small RNA micro-RNA miRNA


Please note that when opening an Illumina sequence fastq file it is expected that the first thousands of reads are of comparatively low quality and frequently might contain “N”s.  An “N” means that the Illumina software was not able to make a basecall for this base.  The reads at the beginning and the end of the sequence data files do originate from the edges of the flowcells,  where the imaging is more difficult.  These reads always show below average quality because of this.  Thus, it is in many cases best to ignore the first  and last 100,000 reads of an Illumina dataset since they are not at all representative.
To verify the data quality of the entire dataset it is recommended to run a program like FASTQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/).  FASTQC  will summarize the data quality for you and run multiple other analyses on your data. Please note that these additional analyses expect that the data were generated by whole genome shotgun sequencing – thus they will usually result in many warnings that are not applicable to other data types.

Strand-Specific RNA Libraries
By default we generate strand-specific RNA-seq libraries. Strand-specific (also known as stranded or directional) RNA-seq libraries substantially enhance the value of an RNA-seq experiment. They add information on the originating strand and thus can precisely delineate the boundaries of transcripts in regions with genes on opposite strands.

There are several ways to accomplish strand-specificity.  We incorporate dUTP during the second-stand synthesis of the cDNA.  The dUTP containing strand will not be amplified by the archaea polymerase used for library amplification, thus preserving the strand information for RNA-seq.  

For single-end sequencing the resulting data will represent the “anti-sense strand”.   When using paired-end sequencing, the forward read of the resulting sequencing data represents the “anti-sense strand” and the reverse read the “sense strand” of the genes (for Trinity transcriptome assemblies the “–RF” orientation flag should be used). Illumina paired-end reads are always inward oriented (with the exception of “jumping” or  “mate-pair” libraries).


We do deliver sequencing data via two portals: SLIMS for Illumina data and BioShare for PacBio data.  Both portals offer secure access to the data an support several download protocols.

Since high throughput sequencing data files tend to be big it is recommended to download the data by running the “wget” command line tool (built-in on Unix/Linux/Cygwin). Wget can easily be added to Windows10 as part of bash and is also available for other Windows systems and MACs (multiple install options).  There is also an easy graphical user interface version available for Windows.

The emails that will notify you about new sequencing data on SLIMS will contain instructions.  In BioShare the instructions for several download protocols are integrated in the user interface. BioShare will automatically generate the download commands for you.

For  SLIMS a wget command like the following will be used to download all files into your current working directory. :
wget -r -nH -nc -np -R index.html*    "http://slims.bioinformatics.ucdavis.edu/Data/Your_RANDOM_STRING/" &

You can also download the files with your webbrowser (clicking the links) or better with a download manager (e.g for Firefox https://addons.mozilla.org/en-US/firefox/addon/downthemall/ )

RSYNC download is possible for both SLIMS and BioShare. Please contact Adam Schaal for assistance with the SSH keys.


Be default we will demultiplex all sequencing data from libraries generated by our facility as well as from customer libraries with barcodes sequenced in separate indexing reads  (e.g. using Truseq-style adapters).  This is in contrast to adapters with old style in-line barcode data.  Data for these have to be demultiplexed by the customer.
The de-multiplexing is included in the sequencing recharge rates.  There are no additional costs.