We are using the PerkinElmer NEXTflex™ Small RNA-Seq kit for the generation of micro RNA and small RNA-seq libraries because it significantly reduces sequence-specific biases in the library preparation. For this purpose the adapters oligonucleotides contain 4 randomized bases at the ligation junctions. These randomized bases should be removed by trimming before mapping the sequence reads. BiooScientific recommends this procedure:
Data Analysis for micro RNA data generated with the PerkinElmer kits:
The 3′ and 5′ adapters included in this kit both contain 4 random bases that will appear immediately 5′ and 3′ to the insert in sequencing data. The presence of these random bases should be considered when choosing an alignment strategy. When using “end-to-end” alignment, we recommend processing data in the following manner: 1. Clip the 3′ adapter sequence (TGGAATTCTCGGGTGCCAAGG ; this sequence fragment is sufficient!). 2. Trim the first and last 4 bases from the adapter-clipped reads. 3. Perform alignments as normal. Alternatively, alignment may be performed in “local” mode.
Please find the full adapter sequences for your reference here: Bioo-Scientific-Small-RNA-Barcode-Indices-v1-1-15 adapters barcodes small RNA micro-RNA miRNA
← FAQ
